Dendritic Cell Focusing on of Bovine Viral Diarrhea Virus

Protein inhibitor of activated STAT genes are differentially expressed in breast tumor tissues.

Goal: Protein inhibitor of activated STAT (PIAS) household consists of transcriptional regulator proteins with SUMO E3 ligase exercise. They regulate expression of a number of genes concerned in cell proliferation, differentiation and survival. 

Methodology: We evaluated expression of PIAS1-4 genes in 54 breast most cancers tissues and their paired adjoining noncancerous tissues. 

Outcomes:PIAS2 and PIAS3 genes had been considerably downregulated in tumoral tissues in contrast with adjoining noncancerous tissues. PIAS1-3 expressions had been considerably decrease in estrogen receptor (ER+) samples in contrast with ER- samples whereas PIAS4 had the other pattern. PIAS3 expression was considerably greater in grade 1 samples in contrast with grade 2 samples.

 Conclusion: These findings spotlight the position of PIAS genes within the pathogenesis of breast most cancers and their affiliation with determinants of response to antihormone therapies.

Dendritic Cell Focusing on of Bovine Viral Diarrhea Virus E2 ProteinExpressed by Lactobacillus casei Successfully Induces Antigen-Particular Immune Responses through Oral Vaccination.

Bovine viral diarrhea brought on by bovine viral diarrhea virus (BVDV) is a crucial illness in cattle, leading to important financial losses to the cattle trade worldwide. As a way to develop an efficient vaccine in opposition to BVDV an infection, we constructed a dendritic cell (DC)-targeting oral probiotic vaccine (pPG-E2-DCpep/LC W56) utilizing Lactobacillus casei as antigen supply provider to specific BVDV glycoprotein E2 fused with DC-targeting peptide, and the immunogenicity of orally administered probiotic vaccine was evaluated in mice mannequin.

 Our outcomes confirmed that after immunization with the probiotic vaccine, considerably ranges of antigen-specific sera IgG and mucosal sIgA antibodies (p < 0.05) with BVDV-neutralizing exercise had been induced in vivo. Problem experiment confirmed that pPG-E2-DCpep/LC W56 can present efficient immune safety in opposition to BVDV, and BVDV may very well be successfully cleared from the gut of immunized mice post-challenge. Furthermore, the pPG-E2-DCpep/LC W56 may effectively activate DCs within the intestinal Peyer’s patches, and considerably ranges of lymphoproliferative responses,

 Th1-associated IFN-γ, and Th2-associated IL-Four had been noticed in mice immunized with pPG-E2-DCpep/LC W56 (p < 0.01). Our outcomes clearly exhibit that the probiotic vaccine may effectively induce anti-BVDV mucosal, humoral, and mobile immune responses through oral immunization, indicating a promising technique for the event of oral vaccine in opposition to BVDV.


Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

DNAJB14 antibody

70R-16875 50 ul
EUR 435
Description: Rabbit polyclonal DNAJB14 antibody

DNAJB14 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNAJB14 Antibody

DF12198 200ul
EUR 304
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.

DNAJB14 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJB14 Polyclonal Antibody

30628-100ul 100ul
EUR 252

DNAJB14 Polyclonal Antibody

30628-50ul 50ul
EUR 187

DNAJB14 Polyclonal Antibody

A66234 100 µg
EUR 570.55
Description: reagents widely cited


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNAJB14 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DNAJB14 Polyclonal Conjugated Antibody

C30628 100ul
EUR 397

DNAJB14 Blocking Peptide

DF12198-BP 1mg
EUR 195

DNAJB14 cloning plasmid

CSB-CL819454HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa
  • Show more
Description: A cloning plasmid for the DNAJB14 gene.

DNAJB14 Rabbit pAb

A4990-100ul 100 ul
EUR 308

DNAJB14 Rabbit pAb

A4990-200ul 200 ul
EUR 459

DNAJB14 Rabbit pAb

A4990-20ul 20 ul
EUR 183

DNAJB14 Rabbit pAb

A4990-50ul 50 ul
EUR 223

DNAJB14 Polyclonal Antibody, HRP Conjugated

A66235 100 µg
EUR 570.55
Description: Ask the seller for details

DNAJB14 Polyclonal Antibody, FITC Conjugated

A66236 100 µg
EUR 570.55
Description: The best epigenetics products

DNAJB14 Polyclonal Antibody, Biotin Conjugated

A66237 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280


EF009156 96 Tests
EUR 689

Mouse DNAJB14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNAJB14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNAJB14 Recombinant Protein (Human)

RP009529 100 ug Ask for price

DNAJB14 Recombinant Protein (Rat)

RP198299 100 ug Ask for price

DNAJB14 Recombinant Protein (Mouse)

RP129476 100 ug Ask for price

Dnajb14 ORF Vector (Rat) (pORF)

ORF066101 1.0 ug DNA
EUR 506

DNAJB14 ORF Vector (Human) (pORF)

ORF003177 1.0 ug DNA
EUR 95

Dnajb14 ORF Vector (Mouse) (pORF)

ORF043160 1.0 ug DNA
EUR 506

DNAJB14 sgRNA CRISPR Lentivector set (Human)

K0614501 3 x 1.0 ug
EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Rat)

K6216401 3 x 1.0 ug
EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Mouse)

K4586901 3 x 1.0 ug
EUR 339

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

abx232446-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)

K0614502 1.0 ug DNA
EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)

K0614503 1.0 ug DNA
EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)

K0614504 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6216402 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6216403 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6216404 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4586902 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4586903 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4586904 1.0 ug DNA
EUR 154

DNAJB14 Protein Vector (Mouse) (pPB-C-His)

PV172638 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPB-N-His)

PV172639 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-HA)

PV172640 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-His)

PV172641 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPB-C-His)

PV264402 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPB-N-His)

PV264403 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-HA)

PV264404 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-His)

PV264405 500 ng
EUR 603

DNAJB14 Protein Vector (Human) (pPB-C-His)

PV012705 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPB-N-His)

PV012706 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-HA)

PV012707 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-His)

PV012708 500 ng
EUR 329

Dnajb14 3'UTR GFP Stable Cell Line

TU155250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line

TU105250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line

TU203509 1.0 ml Ask for price

Dnajb14 3'UTR GFP Stable Cell Line

TU253509 1.0 ml Ask for price

DNAJB14 3'UTR GFP Stable Cell Line

TU056138 1.0 ml
EUR 2333

DNAJB14 3'UTR Luciferase Stable Cell Line

TU006138 1.0 ml
EUR 2333

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT

ELI-26399h 96 Tests
EUR 824

Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT

ELI-08275m 96 Tests
EUR 865

Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit

abx386930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT

ELI-31942b 96 Tests
EUR 928

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0614505 3 x 1.0 ug
EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6216405 3 x 1.0 ug
EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4586905 3 x 1.0 ug
EUR 376

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0614506 1.0 ug DNA
EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0614507 1.0 ug DNA
EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0614508 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6216406 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6216407 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6216408 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4586906 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4586907 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4586908 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Differentially expressed mRNAs, proteins and miRNAs related to vitality metabolism in skeletal muscle of beef cattle recognized for high and low residual feed consumption.

Feed effectivity is likely one of the most essential parameters that have an effect on beef manufacturing prices. The vitality metabolism of skeletal muscle drastically contributes to variations in feed effectivity.

  • Nonetheless, info relating to variations in proteins concerned within the vitality metabolism of the skeletal muscle in beef cattle divergently recognized for feed effectivity is scarce.
  • On this research, we aimed to analyze vitality metabolism of skeletal muscle of Nellore beef cattle, recognized for high and low residual feed consumption utilizing a proteomics strategy.
  • We additional assessed the expression of candidate microRNAs as a one of many doable mechanisms controlling the biosynthesis of the proteins concerned in vitality metabolism that had been differentially ample between excessive and low residual feed consumption animals.
  • A better abundance of 14-3-Three protein epsilon (P = 0.01) was noticed in skeletal muscle of residual feed consumption (RFI) excessive animals (RFI-Excessive).
  • Conversely, a better abundance of Warmth Shock Protein Beta 1 (P < 0.01) was noticed within the skeletal muscle of RFI-Low cattle. A better mRNA expression of YWHAE, which encodes the 14-3-Three protein epsilon, was additionally noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01).

A decrease mRNA expression of HSPB1, which encodes the Warmth Shock Protein Beta 1, was noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01). The miR-665 was recognized as a possible regulator of the 14-3-Three protein epsilon, and its expression was better in RFI-Low animals (P < .001).

A better expression of miR-34a (P = 0.01) and miR-2899 (P < .001) was noticed within the skeletal muscle of RFI-Excessive animals, as each miRNAs had been recognized as potential regulators of HSPB1 expression.Our outcomes present that Nellore cattle divergently recognized for feed effectivity by RFI current modifications within the abundance of proteins concerned in vitality expenditure in skeletal muscle.

 Furthermore, our knowledge level in the direction of that miR-665, miR34a and miR-2899 are doubtless concerned in controlling each 14-3-Three epsilon and HSPB1 proteins recognized as differentially ample within the skeletal muscle of RFI-Excessive and RFI-Low Nellore cattle.

Dnalc4 ORF Vector (Mouse) (pORF)

ORF043215 1.0 ug DNA
EUR 506

Dnalc4 sgRNA CRISPR Lentivector set (Mouse)

K4997501 3 x 1.0 ug
EUR 339

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4997502 1.0 ug DNA
EUR 154

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4997503 1.0 ug DNA
EUR 154

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4997504 1.0 ug DNA
EUR 154

Dnalc4 Protein Vector (Mouse) (pPB-C-His)

PV172858 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPB-N-His)

PV172859 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPM-C-HA)

PV172860 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPM-C-His)

PV172861 500 ng
EUR 603

Dnalc4 3'UTR GFP Stable Cell Line

TU155288 1.0 ml Ask for price

Dnalc4 3'UTR Luciferase Stable Cell Line

TU105288 1.0 ml Ask for price

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4997505 3 x 1.0 ug
EUR 376

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4997506 1.0 ug DNA
EUR 167

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4997507 1.0 ug DNA
EUR 167

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4997508 1.0 ug DNA
EUR 167

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody

AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatitis C Virus Antibody (HCV) Antibody

abx023924-1mg 1 mg
EUR 1205
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti Deoxyribonucleic Acid Antibody (DNA) Antibody

abx411057-50ug 50 ug
EUR 592
  • Shipped within 1 week.

Anti-Glycoprotein 210 Antibody (gp210) Antibody

abx233571-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-100ul 100ul
EUR 333

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-50ul 50ul
EUR 239

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Antibody Pair to ApoA-V antibody

10R-1876 100 ul
EUR 651
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Goat anti- human Antibody^Polyclonal antibody

LSMab09896 100 ug
EUR 438

Anti-Noelin Antibody BIOTIN Antibody BIOTIN

STJ501938 100 µg
EUR 586

Anti-Noelin Antibody FITC Antibody FITC

STJ501939 100 µg
EUR 586

Anti-Noelin Antibody BIOTIN Antibody BIOTIN

STJ501940 100 µg
EUR 586

Anti-Noelin Antibody FITC Antibody FITC

STJ501941 100 µg
EUR 586

Antibody for Human alpha Tubulin Antibody

SPC-692D 0.1mg
EUR 354
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 390.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 488.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 565.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 633.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 655.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 680.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 700.

Antibody for Human alpha Tubulin Antibody

SPC-692D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Alkaline Phosphatase.

Antibody for Human alpha Tubulin Antibody

SPC-692D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC .

Antibody for Human alpha Tubulin Antibody

SPC-692D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC/Cy7.

Antibody for Human alpha Tubulin Antibody

SPC-692D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Biotin.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 350.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 405.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 488.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 633.

Antibody for Human alpha Tubulin Antibody

SPC-692D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to FITC.

Antibody for Human alpha Tubulin Antibody

SPC-692D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to HRP.

Antibody for Human alpha Tubulin Antibody

SPC-692D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PE/ATTO 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PerCP.

Antibody for Human alpha Tubulin Antibody

SPC-692D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to RPE .

Antibody for Human alpha Tubulin Antibody

SPC-692D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Streptavidin.

Antibody for Human alpha Tubulin Antibody

SPC-692S 0.012mg
EUR 65
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Anti-IgG1 Negative Control Antibody antibody

STJ16100881 1 mL
EUR 478

AXL Antibody

AF8412 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of total AXL.

MUC1 Antibody

AF8524 200ul
EUR 376
Description: MUC1 Antibody detects endogenous levels of total MUC1.

A1Up Antibody

AF9002 200ul
EUR 304
Description: A1Up Antibody detects endogenous levels of total A1Up.

Acrosin Antibody

AF9003 200ul
EUR 304
Description: Acrosin Antibody detects endogenous levels of total Acrosin.

AIFL Antibody

AF9005 200ul
EUR 304
Description: AIFL Antibody detects endogenous levels of total AIFL.

AMPKgamma2 Antibody

AF9006 200ul
EUR 304
Description: AMPKgamma2 Antibody detects endogenous levels of total AMPKgamma2.

ANKRD20 Antibody

AF9008 200ul
EUR 304
Description: ANKRD20 Antibody detects endogenous levels of total ANKRD20.

APOBEC3A Antibody

AF9009 200ul
EUR 304
Description: APOBEC3A Antibody detects endogenous levels of total APOBEC3A.

ApoOL Antibody

AF9010 200ul
EUR 304
Description: ApoOL Antibody detects endogenous levels of total ApoOL.

ARHGAP1 Antibody

AF9011 200ul
EUR 304
Description: ARHGAP1 Antibody detects endogenous levels of total ARHGAP1.

ARHGAP22 Antibody

AF9012 200ul
EUR 304
Description: ARHGAP22 Antibody detects endogenous levels of total ARHGAP22.

ARHGEF19 Antibody

AF9013 200ul
EUR 304
Description: ARHGEF19 Antibody detects endogenous levels of total ARHGEF19.

ARMCX1 Antibody

AF9014 200ul
EUR 304
Description: ARMCX1 Antibody detects endogenous levels of total ARMCX1.

Arrdc1 Antibody

AF9016 200ul
EUR 304
Description: Arrdc1 Antibody detects endogenous levels of total Arrdc1.

ARRDC2 Antibody

AF9017 200ul
EUR 304
Description: ARRDC2 Antibody detects endogenous levels of total ARRDC2.

Arrdc4 Antibody

AF9018 200ul
EUR 304
Description: Arrdc4 Antibody detects endogenous levels of total Arrdc4.

ASF1B Antibody

AF9022 200ul
EUR 304
Description: ASF1B Antibody detects endogenous levels of total ASF1B.

BAM32 Antibody

AF9023 200ul
EUR 304
Description: BAM32 Antibody detects endogenous levels of total BAM32.

BEGAIN Antibody

AF9024 200ul
EUR 304
Description: BEGAIN Antibody detects endogenous levels of total BEGAIN.

BRD3 Antibody

AF9025 200ul
EUR 304
Description: BRD3 Antibody detects endogenous levels of total BRD3.

BTBD6 Antibody

AF9026 200ul
EUR 304
Description: BTBD6 Antibody detects endogenous levels of total BTBD6.

Cables2 Antibody

AF9029 200ul
EUR 304
Description: Cables2 Antibody detects endogenous levels of total Cables2.