Dendritic Cell Focusing on of Bovine Viral Diarrhea Virus

Protein inhibitor of activated STAT genes are differentially expressed in breast tumor tissues.

Goal: Protein inhibitor of activated STAT (PIAS) household consists of transcriptional regulator proteins with SUMO E3 ligase exercise. They regulate expression of a number of genes concerned in cell proliferation, differentiation and survival. 

Methodology: We evaluated expression of PIAS1-4 genes in 54 breast most cancers tissues and their paired adjoining noncancerous tissues. 

Outcomes:PIAS2 and PIAS3 genes had been considerably downregulated in tumoral tissues in contrast with adjoining noncancerous tissues. PIAS1-3 expressions had been considerably decrease in estrogen receptor (ER+) samples in contrast with ER- samples whereas PIAS4 had the other pattern. PIAS3 expression was considerably greater in grade 1 samples in contrast with grade 2 samples.

 Conclusion: These findings spotlight the position of PIAS genes within the pathogenesis of breast most cancers and their affiliation with determinants of response to antihormone therapies.

Dendritic Cell Focusing on of Bovine Viral Diarrhea Virus E2 ProteinExpressed by Lactobacillus casei Successfully Induces Antigen-Particular Immune Responses through Oral Vaccination.

Bovine viral diarrhea brought on by bovine viral diarrhea virus (BVDV) is a crucial illness in cattle, leading to important financial losses to the cattle trade worldwide. As a way to develop an efficient vaccine in opposition to BVDV an infection, we constructed a dendritic cell (DC)-targeting oral probiotic vaccine (pPG-E2-DCpep/LC W56) utilizing Lactobacillus casei as antigen supply provider to specific BVDV glycoprotein E2 fused with DC-targeting peptide, and the immunogenicity of orally administered probiotic vaccine was evaluated in mice mannequin.

 Our outcomes confirmed that after immunization with the probiotic vaccine, considerably ranges of antigen-specific sera IgG and mucosal sIgA antibodies (p < 0.05) with BVDV-neutralizing exercise had been induced in vivo. Problem experiment confirmed that pPG-E2-DCpep/LC W56 can present efficient immune safety in opposition to BVDV, and BVDV may very well be successfully cleared from the gut of immunized mice post-challenge. Furthermore, the pPG-E2-DCpep/LC W56 may effectively activate DCs within the intestinal Peyer’s patches, and considerably ranges of lymphoproliferative responses,

 Th1-associated IFN-γ, and Th2-associated IL-Four had been noticed in mice immunized with pPG-E2-DCpep/LC W56 (p < 0.01). Our outcomes clearly exhibit that the probiotic vaccine may effectively induce anti-BVDV mucosal, humoral, and mobile immune responses through oral immunization, indicating a promising technique for the event of oral vaccine in opposition to BVDV.

konka-chemica
konka-chemica

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349

DNAJB14 antibody
70R-16875 50 ul
EUR 435
Description: Rabbit polyclonal DNAJB14 antibody

DNAJB14 Antibody
1-CSB-PA819454LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNAJB14 Antibody
DF12198 200ul
EUR 304
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.

DNAJB14 Antibody
1-CSB-PA007007GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJB14 Polyclonal Antibody
30628-100ul 100ul
EUR 252

DNAJB14 Polyclonal Antibody
30628-50ul 50ul
EUR 187

DNAJB14 Polyclonal Antibody
A66234 100 µg
EUR 570.55
Description: reagents widely cited

DNAJB14 siRNA
20-abx914343
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNAJB14 siRNA
20-abx914344
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNAJB14 Antibody, HRP conjugated
1-CSB-PA819454LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, FITC conjugated
1-CSB-PA819454LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, Biotin conjugated
1-CSB-PA819454LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DNAJB14 Polyclonal Conjugated Antibody
C30628 100ul
EUR 397

DNAJB14 Blocking Peptide
DF12198-BP 1mg
EUR 195

DNAJB14 cloning plasmid
CSB-CL819454HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa
  • Show more
Description: A cloning plasmid for the DNAJB14 gene.

DNAJB14 Rabbit pAb
A4990-100ul 100 ul
EUR 308

DNAJB14 Rabbit pAb
A4990-200ul 200 ul
EUR 459

DNAJB14 Rabbit pAb
A4990-20ul 20 ul
EUR 183

DNAJB14 Rabbit pAb
A4990-50ul 50 ul
EUR 223

DNAJB14 Polyclonal Antibody, HRP Conjugated
A66235 100 µg
EUR 570.55
Description: Ask the seller for details

DNAJB14 Polyclonal Antibody, FITC Conjugated
A66236 100 µg
EUR 570.55
Description: The best epigenetics products

DNAJB14 Polyclonal Antibody, Biotin Conjugated
A66237 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

DNAJB14 ELISA KIT|Human
EF009156 96 Tests
EUR 689

Mouse DNAJB14 shRNA Plasmid
20-abx977260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNAJB14 shRNA Plasmid
20-abx962706
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNAJB14 Recombinant Protein (Human)
RP009529 100 ug Ask for price

DNAJB14 Recombinant Protein (Rat)
RP198299 100 ug Ask for price

DNAJB14 Recombinant Protein (Mouse)
RP129476 100 ug Ask for price

Dnajb14 ORF Vector (Rat) (pORF)
ORF066101 1.0 ug DNA
EUR 506

DNAJB14 ORF Vector (Human) (pORF)
ORF003177 1.0 ug DNA
EUR 95

Dnajb14 ORF Vector (Mouse) (pORF)
ORF043160 1.0 ug DNA
EUR 506

DNAJB14 sgRNA CRISPR Lentivector set (Human)
K0614501 3 x 1.0 ug
EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Rat)
K6216401 3 x 1.0 ug
EUR 339

Dnajb14 sgRNA CRISPR Lentivector set (Mouse)
K4586901 3 x 1.0 ug
EUR 339

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx003806
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx112129
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx302018
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
abx232446-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0614502 1.0 ug DNA
EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0614503 1.0 ug DNA
EUR 154

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0614504 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6216402 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6216403 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6216404 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4586902 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4586903 1.0 ug DNA
EUR 154

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4586904 1.0 ug DNA
EUR 154

DNAJB14 3'UTR Luciferase Stable Cell Line
TU006138 1.0 ml
EUR 2333

Dnajb14 3'UTR GFP Stable Cell Line
TU155250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line
TU105250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line
TU203509 1.0 ml Ask for price

Dnajb14 3'UTR GFP Stable Cell Line
TU253509 1.0 ml Ask for price

DNAJB14 3'UTR GFP Stable Cell Line
TU056138 1.0 ml
EUR 2333

DNAJB14 Protein Vector (Mouse) (pPB-C-His)
PV172638 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPB-N-His)
PV172639 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-HA)
PV172640 500 ng
EUR 603

DNAJB14 Protein Vector (Mouse) (pPM-C-His)
PV172641 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPB-C-His)
PV264402 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPB-N-His)
PV264403 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-HA)
PV264404 500 ng
EUR 603

DNAJB14 Protein Vector (Rat) (pPM-C-His)
PV264405 500 ng
EUR 603

DNAJB14 Protein Vector (Human) (pPB-C-His)
PV012705 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPB-N-His)
PV012706 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-HA)
PV012707 500 ng
EUR 329

DNAJB14 Protein Vector (Human) (pPM-C-His)
PV012708 500 ng
EUR 329

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)
20-abx308795
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)
20-abx308796
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)
20-abx308797
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-26399h 96 Tests
EUR 824

Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT
ELI-08275m 96 Tests
EUR 865

Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit
abx386930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-31942b 96 Tests
EUR 928

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0614505 3 x 1.0 ug
EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6216405 3 x 1.0 ug
EUR 376

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4586905 3 x 1.0 ug
EUR 376

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0614506 1.0 ug DNA
EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0614507 1.0 ug DNA
EUR 167

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0614508 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6216406 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6216407 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6216408 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4586906 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4586907 1.0 ug DNA
EUR 167

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4586908 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Differentially expressed mRNAs, proteins and miRNAs related to vitality metabolism in skeletal muscle of beef cattle recognized for high and low residual feed consumption.

Feed effectivity is likely one of the most essential parameters that have an effect on beef manufacturing prices. The vitality metabolism of skeletal muscle drastically contributes to variations in feed effectivity.

  • Nonetheless, info relating to variations in proteins concerned within the vitality metabolism of the skeletal muscle in beef cattle divergently recognized for feed effectivity is scarce.
  • On this research, we aimed to analyze vitality metabolism of skeletal muscle of Nellore beef cattle, recognized for high and low residual feed consumption utilizing a proteomics strategy.
  • We additional assessed the expression of candidate microRNAs as a one of many doable mechanisms controlling the biosynthesis of the proteins concerned in vitality metabolism that had been differentially ample between excessive and low residual feed consumption animals.
  • A better abundance of 14-3-Three protein epsilon (P = 0.01) was noticed in skeletal muscle of residual feed consumption (RFI) excessive animals (RFI-Excessive).
  • Conversely, a better abundance of Warmth Shock Protein Beta 1 (P < 0.01) was noticed within the skeletal muscle of RFI-Low cattle. A better mRNA expression of YWHAE, which encodes the 14-3-Three protein epsilon, was additionally noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01).

A decrease mRNA expression of HSPB1, which encodes the Warmth Shock Protein Beta 1, was noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01). The miR-665 was recognized as a possible regulator of the 14-3-Three protein epsilon, and its expression was better in RFI-Low animals (P < .001).

A better expression of miR-34a (P = 0.01) and miR-2899 (P < .001) was noticed within the skeletal muscle of RFI-Excessive animals, as each miRNAs had been recognized as potential regulators of HSPB1 expression.Our outcomes present that Nellore cattle divergently recognized for feed effectivity by RFI current modifications within the abundance of proteins concerned in vitality expenditure in skeletal muscle.

 Furthermore, our knowledge level in the direction of that miR-665, miR34a and miR-2899 are doubtless concerned in controlling each 14-3-Three epsilon and HSPB1 proteins recognized as differentially ample within the skeletal muscle of RFI-Excessive and RFI-Low Nellore cattle.

Dnalc4 ORF Vector (Mouse) (pORF)
ORF043215 1.0 ug DNA
EUR 506

Dnalc4 sgRNA CRISPR Lentivector set (Mouse)
K4997501 3 x 1.0 ug
EUR 339

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4997502 1.0 ug DNA
EUR 154

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4997503 1.0 ug DNA
EUR 154

Dnalc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4997504 1.0 ug DNA
EUR 154

Dnalc4 3'UTR GFP Stable Cell Line
TU155288 1.0 ml Ask for price

Dnalc4 3'UTR Luciferase Stable Cell Line
TU105288 1.0 ml Ask for price

Dnalc4 Protein Vector (Mouse) (pPB-C-His)
PV172858 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPB-N-His)
PV172859 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPM-C-HA)
PV172860 500 ng
EUR 603

Dnalc4 Protein Vector (Mouse) (pPM-C-His)
PV172861 500 ng
EUR 603

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4997505 3 x 1.0 ug
EUR 376

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4997506 1.0 ug DNA
EUR 167

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4997507 1.0 ug DNA
EUR 167

Dnalc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4997508 1.0 ug DNA
EUR 167

H2B Antibody Antibody
AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody
ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody
LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody
20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-100ul 100ul
EUR 333

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-50ul 50ul
EUR 239

Antibody Pair to ApoA-V antibody
10R-1876 100 ul
EUR 651
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Hepatitis C Virus Antibody (HCV) Antibody
abx023924-1mg 1 mg
EUR 1205
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103034
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103035
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103036
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody
AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Anti Deoxyribonucleic Acid Antibody (DNA) Antibody
abx411057-50ug 50 ug
EUR 592
  • Shipped within 1 week.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319902
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319903
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319908
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319916
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319929
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319930
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein 210 Antibody (gp210) Antibody
abx233571-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody (HRP)
20-abx311666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (FITC)
20-abx311667
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (Biotin)
20-abx311668
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Goat anti- human Antibody^Polyclonal antibody
LSMab09896 100 ug
EUR 438

Antibody for Human alpha Tubulin Antibody
SPC-692D 0.1mg
EUR 354
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 390.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 488.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 565.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 594.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 633.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 655.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 680.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 700.

Antibody for Human alpha Tubulin Antibody
SPC-692D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Alkaline Phosphatase.

Antibody for Human alpha Tubulin Antibody
SPC-692D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC .

Antibody for Human alpha Tubulin Antibody
SPC-692D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC/Cy7.

Antibody for Human alpha Tubulin Antibody
SPC-692D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Biotin.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 350.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 405.